1098
Views & Citations98
Likes & Shares
Down’s syndrome (DS) has lately been gaining attention among
researchers due to its genetic significance leading to dementia and Alzheimer's
disease. The aim of the present study was to investigate the possible
interaction between thyroid hormone and total homocysteine levels by analyzing
the patterns of chromosomal abnormalities and genetic polymorphisms of the
methionine synthase reductase (MTRR)
gene among DS children, mothers of DS children (MDS) and their respective
controls. Free trisomy was present in 57%, translocation in 10% and mosaicism
in 33% of DS children from mothers with abnormal thyroid hormonal and
homocysteine levels. A combination of the heterozygous and homozygous MTRR variant (AG+GG) showed a highly
significant increase in the prevalence of the A66G mutation among MDS. The
prevalence of the GG homozygous variant was significantly higher in MDS
compared to controls. Although the confinement of this study to a specific
geographic region of India and the relatively small sample size, our observations
support the integration of genetic analysis and biochemical tests for a
potential prognosis of DS that could enable the implementation of prophylactic
treatments.
Keywords: Down’s Syndrome,
Cytogenetics, Homocysteine, Hypothyroidism, Micronuclei, MTRR genotype
INTRODUCTION
Down’s
syndrome (DS; trisomy 21) is the second commonest serious birth defect, after
neural tube defects, and is the most common survivable chromosomal abnormality,
with an estimated >217,000 live births per year. In the USA, DS occurs in
one of every 800 infants with as many as 6,000 children born with DS each year.
Approximately 85–90% of individuals born with DS can be expected to survive to
one year of age and over 50% will be expected to survive beyond 50 years [1].
According to the National Down’s Syndrome Society, there are more than 350,000
people living with DS in the USA.
DS is registered in nearly all surveillance programs for birth defects
as a paradigm for aneuploid mutations. The conspicuous DS phenotype and the
high proportion of new mutants make surveillance of trisomy 21 particularly
suitable for assessing mutagenic hazards and identifying genetic factors
influencing non-disjunction. Approximately 95% of the cases are due to
non-disjunction, resulting in an extra copy of a chromosome 21 (trisomy 21) as
described by Lejeune et al. [2,3]. The remainders are due to translocations
involving chromosome 21 and somatic mosaicism [4]. Most trisomy 21 cases are
due to an error in maternal meiosis, whereby about 70% originate during
maternal meiosis I, about 20% during maternal meiosis II and 8-10% due to
defective paternal meiosis [4,5]. Even though significant progress has been
made in recent years, the causes of the increased non-disjunction rate
resulting in trisomy 21 are far from understood. Maternal age, germline
mosaicism, and altered recombination remain the only well-established risk
factors for non-disjunction of chromosome 21 [4].
An important factor relating DS with one-carbon metabolism is the
cystathionine beta synthase (CBS)
gene located on chromosome 21. This location would explain the functional
homocysteine (Hcy) deficiency observed in infants with trisomy 21, due to the
over-expression of the CBS gene [6]. Therefore,
the functional Hcy deficiency in embryos with three chromosomes 21 could
diminish the levels of S-adenosylmethionine (SAM), provoking unrestricted
5-methyltetrahydrofolate formation and conserving Hcy for methionine
production, thereby affecting DNA synthesis. This destabilization of Hcy
metabolism might alter cell division and growth and, therefore, embryo
survival, which may be related to the well-known high lethality of trisomy 21
at conception [7].
Among the genetic factors that could be related to centromeric
hypomethylation are the polymorphic variants of enzymes in the methionine
homocysteine metabolic pathway, such as methylenetetrahydrofolate reductase (MTHFR),
methionine synthase (MTR), and methionine synthase reductase (MTRR) [8]. These
enzymes are involved in the regulation of S-adenosylmethionine (SAM), the main
intracellular donor of methyl groups to DNA and other substrates. These
enzymatic variants could alter normal metabolic pathways, resulting in
increased levels of homocysteine, decreased SAM synthesis, and abnormal DNA
methylation.
The focal aim of the present study was directed at the population of
Coimbatore, South India, to detect the different patterns of chromosomal
abnormalities of suspected DS patients by cytogenetic analysis using the
trypsin G-banding method; to analyze the frequency of micronucleus (MN) and
binucleated cells in mothers of DS children (MDS), DS cases and controls, and
to investigate the possible influence of thyroid hormone [Free Thyroxine (FT4),
thyroid stimulating hormone (TSH)] and plasma total homocysteine (tHcy) levels
in MDS, DS and controls. The study also investigated single nucleotide
polymorphisms (SNP) in the methionine synthase reductase (MTRR) gene.
MATERIALS AND
METHODS
Subject
recruitment and sample collection
Experimental samples were selected from the hospitals in and around
Coimbatore City, Tamilnadu, India, from September 2015 to August 2016. Mentally
normal and physically healthy individuals residing in the same area were
selected as controls, with their ages ranging within ± 2 years of their DS
counterparts. 100 samples taken for this study included 30
children with DS who had been reported to the clinic during the study period,
30 mothers of DS children (MDS), 20 normal children and 20 normal mothers. The
minimum onset age of MDS experimental samples was considered at 30 years. A
detailed questionnaire was directed to both subject groups to obtain relevant
details such as smoking and alcohol consumption. Other health effects such as thyroid
dysfunction, respiratory issues, skin disorders, reproductive effects, child
age, birth order, parental age, marital status, family history and clinical
features were also recorded.
For the present study, 5 mL of blood was collected intravenously from
the individuals and brought to the culture laboratory in airtight ice-packed
containers to perform the chromosomal (peripheral blood leukocyte culturing and
micronucleus analysis), biochemical (Enzyme Immunoassay for Quantitative
Determination of Serum Free T4 (FT4) and Immunoassay for the Quantitative
Determination of Thyroid Stimulating Hormone (TSH)), and genotypic (PCR-RFLP
analysis of MTRR gene polymorphism)
analyses. Serum was separated from the blood samples and assayed for various
hematological parameters (Enzyme Immunoassay for the Quantitative Determination
of (tHcy) in Human Serum).
Human Peripheral
Blood Leukocyte culture for chromosomal analysis
5 mL of peripheral blood was collected from exposed and control
subjects using a heparinized syringe, for peripheral blood leukocyte culture
following the method of Moorhead et al. [9]. The chromosomal preparations
obtained were processed and stained with Giemsa to obtain G-bands.
A modified method of Seabright [10] was employed to obtain chromosomal
bands. The slides bearing chromosome spreads were treated with 0.25% trypsin
for 3 to 10 s to enable the digestion of the cell membrane, the cytoplasm and
to enhance good exposure of the metaphase chromosomes. After trypsin treatment,
the slides were stained in 4% buffered Giemsa solution for 3 min, washed with
distilled water and then air-dried.
Micronucleus study
Scoring of micronuclei was limited to binucleated lymphocytes with
preserved cytoplasm [11], and stained for 5 to 8 min using 2% Giemsa solution
made in 0.025 M phosphate buffer pH 6.8 according to the criteria proposed by
Countryman and Heddle [12]. The results are expressed as the average percentage
of micronucleated cells per binucleated cells. To determine the frequency of
binucleated cells with micronuclei (BNMN) and the total number of micronuclei
in binucleated lymphocytes (MNL), a total of 1,000 binucleated cells (500 per
replicate) with well-preserved cytoplasm were scored per subject on coded
slides.
Biochemical assays
Enzyme immunoassay for quantitative determination of serum free T4
(FT4) and immunoassay for the quantitative determination of thyroid stimulating
hormone (TSH) were performed according to the methods described by Sati et al.
[13] and Soos [14], respectively. The ELISA-based test for analyzing the FT4
was carried out using patient serum samples, standards, and thyroxin-enzyme
conjugate reagent was added to wells coated with monoclonal T4 antibody. The
colored enzyme-substrate complex was read spectrophotometrically at 492 nm. The
Genix TSH EIA test was read at 450 nm using a goat anti-TSH antibody in the
antibody-enzyme (horse radish peroxidase) conjugate solution. Total
homocysteine biochemical assay was carried out using a Cell Biolabs, Inc kit,
using the patient’s serum in reaction with recombinant methionine α,γ-lyase
(HCY enzyme) to produce H2S which was, in turn, measured optically
at 660 nm.
MTRR genotyping
Whole blood was collected in EDTA-coated collection tubes to avoid
clotting, and DNA was extracted using a Genei kit. Standard DNA was prepared
using salmon sperm DNA at various concentrations (10, 25, 50, 75 µg/mL of
distilled water) and was used to quantify the DNA extracted from patient’s
blood. The ratio of reading at OD 260 and 280 nm provided an estimate of DNA
purity.
The primers (Genei, India) used for amplifying genomic DNA were chosen
according to Ulvik et al. [15] for the MTRR gene polymorphism assay. 4 μL of
template DNA, 1 μL each of forward (Primer F–5’ CAAAGGCCATCGCAGAAG 3’) and
reverse primer (Primer R– 5’AAGATCTGCAGAAAATCCATGT 3’), 12.5 μL of 2X PCR
master mix and 8.5 μL of MilliQ water were subjected to an initial denaturing
step at 95°C (10 min) followed by 30 cycles of Denaturation step at 95°C (30s),
Annealing step at 55°C (30 s), Extension step at 72°C (1min) and Final
elongation step at 72°C for 10 min. The PCR products were electrophoresed on 1%
agarose gels containing EtBr and viewed under ultraviolet light.
For digestion of PCR product with NdeI
restriction enzyme, 10 μL of PCR reaction product, 18 μL of nuclease-free
water, 2 μL of 10X restriction enzyme buffer and 2 μL of NdeI enzyme were mixed gently and centrifuged for a few seconds.
The reaction mix was then incubated at 37°C for 8 to 12 h. The digestion
products were viewed on 4% Metaphor agarose gel containing EtBr.
RESULTS
A ratio
of 56.33% of DS children and 55% of the respective controls were females.
Interestingly, statistical differences (p<0.01) were observed between male
and female DS children in terms of clinical features such as flat facial
profile, slightly open mouth, small or absence of earlobes and protruding
tongue. 95% significance was observed between slanted palpebral fissures and
short hands and also between wide feet and wide neck or broad hands (Figure 1).
Table 1 represents the chromosomal
alterations found among DS children. Trisomy 21, translocation and mosaicism
were the major alterations observed in the experimental subjects. Among them,
57% (n=17) of DS patients were found to have trisomy 21 (47, XX, +21 or
47, XY, +21), 10% (n=3) translocations (46, XY, der (14; 21) or 46, XX,
der (14;21), and 33% (n=10) Mosaicism (46, XX/47, XX, +21or 46, XY/47,
XY, +21) (Table 1). The birth frequency of DS babies was higher in the older
mothers (≥35 years, n=18) 60%, than in younger mothers (<35, n =12) 40%.
The Micronucleus Assay (MN) was carried out with peripheral lymphocytes
of patients and their controls (Figure 2D). The mean MN/1000 binucleated cells
were found to be significantly increased (p<0.05) in peripheral lymphocytes
of DS patients when compared to controls and it was significantly higher in MDS
(2.25±1.63), when compared to DS children (0.2±0.40) and their respective
controls (Control children: 0.05±0.22 and control mothers: 0.25±0.44).
Figure 2 (A, B, C) embodies the pooled
data with values of TSH, FT4 and tHcy in DS patients, their mothers and in
controls. Thyroid hormonal and homocysteine levels were found to be abnormal in
mothers of DS subjects. TSH level was significantly higher in MDS (4.01±0.77)
compared to DS children (3.52±0.88) and controls (0.69±0.14, 0.66±0.11) µIU/ml. Levels of FT4 in the MDS group
(0.73±0.57) were lower than in DS (1.77±0.69) and controls (0.79±0.08,
0.76±0.05) ng/dl.
However, tHcy levels in MDS (14.24±2.89) showed higher levels than in DS
(12.11±3.33) and controls (6.09±1.34, 6.28±1.13) µM with no significant variation. The Figure 2D explains the mean MN/1000
binucleated cells were found to be statistically increased (p<0.05) in
peripheral lymphocytes of DS patients when compared to controls and it was
significantly higher in MDS (2.25±1.63), when compared to DS children
(0.2±0.40) and their respective controls (Control children: 0.05±0.22 and
control mothers: 0.25±0.44). A ratio of 67% of MDS showed hypothyroidism and 43% displayed
homocystinuria. However, DS patients only showed 33% and 30% of hypothyroidism
and homocystinuria, respectively (Table
2).
The frequencies of the MTRR genotypes (AA, AG, and GG) in controls were
as follows: control children: 15%, 55%, and 30% control mothers: 15%, 50%, 35%
(Table 3). The corresponding
frequencies among patients were 13%, 47%, and 40% in DS children and 3%, 48%
and 50% in MDS (Table 3). Combining
the heterozygous and homozygous MTRR variants (AG+GG), we observed a very
significant increase in the prevalence of the A66G mutation in MDS (98%). The
prevalence of the GG homozygous variant was significantly higher in MDS
compared to controls (50%). As there was only one MTRR-AA homozygote in the
reference group, odds ratio values must be regarded as imprecise (as shown by
the wide confidence intervals).
DISCUSSION
DS is characterized by a constellation of physical features and
systemic malformations. Kava et al. [16] reported in DS from India Mongoloid
slant, ear abnormalities, epicanthic folds, flat faces, and hypotonia in
>50% of cases. Similar to children with DS, psychiatric disorders are common
in adults with DS compared to adults with intellectual disabilities of other
etiology. Symptoms of delusions and hallucinations may exist together with
social isolation, bland affect, apathy, and sleep disturbance in adults with DS
and psychiatric disorders, and are often wrongly diagnosed as major depression
[17]. Although psychiatric disorders seem uncommon in adults with DS, there
continue to be gaps in knowledge regarding the development and progression of
these problems across the lifespan [18].
A review of over 5,000 cases of DS from laboratories in England and
Wales between 1989 and 1993 revealed that 95% had an extra chromosome 21
resulting from a non-disjunction error during gametogenesis. Less than 1%
showed somatic mosaicism while the rest carried translocations involving
chromosome 21 [19]. Similar frequencies were also documented in other reports
[20,21].
In the present study, our results show free trisomy in 57%,
translocations in 10% and mosaicisms in 33% of the subjects. This was in
accordance with earlier reports from India [16,22,23]. Individuals with
non-classical karyotypes and free trisomy 21 associated with structural and/or
numerical anomalies of other chromosomes have been reported by Mokhtar et al.
[20] and Sheth et al. [24]. Mokhtar et al. [20] also reported a skewed
male:female ratio of 0.67 among mosaics.
A higher incidence of DS in aged mothers reflects meiotic error as a
common cause. The birth frequency of DS babies in younger (<35 years of age,
n =12) mothers is 40% and in mothers of older than 35 years of age, n=18) is 60%.
The mean maternal age was higher in free trisomy 21, but not in
translocations [19]. Chromosomal studies of parents
having children with DS in 13 couples revealed chromosomal variants in
23% (6 of 26 individuals) which did not involve chromosome 21. Chromosomal
variants may predispose to non-disjunction in DS because of an interchromosomal
effect [25].
Thyroid dysfunction, especially hypothyroidism, is more prevalent in
people with DS at all ages. Hypothyroidism can be either congenital or acquired
at any age after birth. The estimated lifetime prevalence rate of thyroid
dysfunction in
DS varied widely in different studies (between 3% and 54% in adult
patients), depending on variations in population size, age, laboratory assays
and definitions of thyroid dysfunction used [26]. However, what is clear from
the literature available to date is that the incidence of congenital
hypothyroidism in DS cases is definitely 30-fold higher than that of the
general population. There are consistent reports demonstrating thyroid status
as an important determinant of the plasma/serum concentration of tHcy
[27,28,29] which has been proposed as an independent risk factor for vascular
occlusive disease [30].
In our study, the increase in Hcy concentrations in cases with
hypothyroidism may be explained by changes in folate status and also by
modifications in enzymes involved in homocysteine metabolism, distribution or
clearance, and/or by concurrent changes in renal function [27]. Transient
hypothyroidism is the most common form of thyroid dysfunction observed in DS
patients. Gibson et al. [31] observed that 47% of subclinical hypothyroid DS
patients were subsequently found to have normal TSH levels after a gap of four
to six years.
Folate and tHcy status and related polymorphisms have been considered
maternal risk factors for DS [32]. Folic acid deficiency has been extensively
associated with an increase in DNA damage in children and adults. Polymorphisms
in folic acid metabolism genes in mothers have been shown to increase the risk
of DS in offspring. It has been speculated whether increased tHcy degradation
explains the low frequency of atherosclerosis in patients with DS [33].
Furthermore, a low tHcy concentration may also decrease the methionine synthase
reaction, which in turn may trap 5-methyltetrahydrofolate and thereby impair
folate function.
The MTRR enzyme catalyzes the
remethylation of homocysteine to methionine via a cobalamin- and
folate-dependent reaction. MTRR has a
crucial role in maintaining cobalamin in an active form and is an important
determinant of homocysteine concentration in plasma. The MTRR gene is located at 5p15.3-p15.2, and a common polymorphism in
the MTRR gene is 66G>A (formerly MTRR 66A>G), which involves an amino
acid substitution from methionine to isoleucine at codon 22 (p.M22I) [34]. The MTRR 66AA genotype seems to contribute
to elevated homocysteine and low folate levels when compared with the MTRR 66GG genotype [35]. In healthy
individuals, plasma homocysteine level and metabolism are well regulated, but
various environmental or genetic factors determine an elevation of the levels
of homocysteine [36].
We found a bi-allelic polymorphism caused by the A→G substitution at
nucleotide 66 which abolishes the NdeI
restriction site. The PCR fragment of 66 bp remained uncut in the presence of
the G (methionine) allele but was digested into fragments of 44 and 22 bp in
the presence of the A (isoleucine) allele.
The frequencies of the MTRR
genotypes (AA, AG, and GG) among controls were 15%, 55%, and 30% in children
and 15%, 50%, 35% in mothers (Table 3).
The corresponding frequencies among the patients were 13%, 47%, and 40% in DS
and 3%, 48% and 50% in MDS. A combination of the heterozygous and homozygous MTRR variant genotypes (AG+GG) showed a
very significant increase in the prevalence of the A66G mutation in MDS (98%).
The prevalence of the GG homozygous variant genotype alone was significantly
higher in MDS compared to controls (50%).
The possibility for non-dysfunction has been indicated when the mothers
of children with DS have a high frequency of the T allele [37,38]. In addition,
Kohli et al. (39) observed the lack of a relationship in their study on north
Indian DS mothers, while a case-control study on Indian mothers of DS children
from a north-eastern state showed a 7.6-fold increase in the frequency of the
TT genotype in the case mothers compared with the controls. [8,40]. Nor was
there preferential transmission of the T allele. In contrast, Devi et al. [41]
found a significant difference in T allele frequency between case and control
parents. The minor allele frequencies in case mothers and fathers were 4.17%
and 6.94%, respectively. However, females were found to have a higher T allele
frequency than males in a large study. Meguid et al. [38] also observed that
the mutant genotype was significantly more common in case mothers than in
controls, indicating a greater genetic impact of this polymorphism. Angeline et
al. [42] found the frequency of 677TT among Tamilians to be 1.38% (1/72) and
that of 677CT heterozygotes to be 18.1%, while the frequencies of 1298AC and
1298CC genotypes were 47.2% and 15.3%, respectively. The frequencies of the T
allele of C677T and the C allele of A1298C in 30 control individuals were 0.17
and 0.45, respectively. James et al. [43] described that micronutrient intake
was suggested to influence the effects of polymorphisms in genes involved in
the folate pathway.
CONCLUSION
Cytogenetic assessment is essential for the confirmation of clinical
diagnosis. In DS, karyotyping is also useful for prevention in successive
pregnancies and genetic counseling. Folic acid and thyroid metabolism are also
determinant in the phenotypic profile of DS cases and their mothers.
Consequently, a pharmacogenomic assessment of DS cases and their parents is
highly recommended for the prevention and treatment of these traits which
influence brain function.
- Cereda A, Carey JC (2012) The
trisomy 18 syndrome. Otphanet J
Rare Dis 7: 81.
- Lejeune J, Turpin R, Gautier
M (1959a) Chromosomic diagnosis of mongolism. Arch Fr Pediatr 16: 962-963.
- Lejeune J, Turpin R, Gautier
M (1959b) Mongolism ; a chromosomal disease (trisomy). Bull Acad Natl Med
143: 256-265.
- Sherman SL, Freeman SB, Allen
EG, Lamb NE (2005) Risk factors for nondisjunction of trisomy 21.
Cytogenet Genome Res 111: 273-280.
- Petersen MB, Mikkelsen M
(2000) Nondisjunction in trisomy 21: origin and mechanisms. Cytogenet Cell
Genet 91: 199-203.
- Pogribna M, Melnyk S,
Pogribny I, Chango A, Yi P, et al. (2001) Homocysteine metabolism in children
with Down syndrome: In vitro modulation. Am J Hum Genet 69: 88–95.
- Patterson D. (2008) Folate
metabolism and the risk of Down syndrome. Down Syndrome Research and Practice 12: 93-97.
- Rai V, Yadav U, Kumar P,
Yadav SK (2013) Analysis of methionine synthase reductase polymorphism
(A66G) in Indian Muslim population. Ind
J Hum Genet 19: 183.
- Moorhead PS, Novell PC,
Mellman WJ, Battips DM, Hungerford DA (1960) Chromosome preparation of
leucocyte culture from peripheral blood. Exp Cell Res 20: 613 – 615.
- Seabright M (1971) A rapid
banding technique for human chromosomes. Lancet 11: 971-972.
- Fenech M, Morley AA (1985)
Solutions to the kinetic problem in the micronucleus assay. Cytobios 43: 233-246.
- Coutryman PI, Heddle JA
(1976) The production of micronuclei from chromosome aberrations in
irradiated cultures of human lymphocytes Mutat Res 41: 321–32.
- Sati C, Chattor AJ, Watts N
(1987) Fundamentals of Clinical Chemistry. Ed. Tietz, N.W. 3rd Ed., pg.
586. Saunders
Press Philadelphia.
- Soos M, Siddle K (1982) Radio
Immunoassay. J Immuno Methods 51: 57-68.
- Ulvik A, Ueland PM (2001)
Single nucleotide polymorphism (SNP) genotyping in unprocessed whole blood
and serum by real-time PCR: Application to SNPs affecting homocysteine and
folate metabolism. Clin Chem 47(11): 2050–2053.
- Kava MP, Tullu MS, Muranjan
MN, Girisha KM (2004) Down syndrome: Clinical profile from India. Archives
Med Res 35: 31–35.
- Capone G, Kim P, Jovanovich S
(2002) Evidence for increased mitochrondrial superoxide production in Down
syndrome. Life Sci 70: 2885–95.
- Dykens EM (2007) Psychiatric
and behavioral disorders in persons with Down syndrome. Ment Retard Dev
Disabil Res Rev 13(2): 272-278.
- Mutton D, Alberman E, Hook EB
(1996) Cytogenetic and epidemiological findings in Down syndrome, England
and Wales (1989) to (1993). National Down Syndrome Cytogenetic Register
and the Association of Clinical Cytogeneticists. J Med Genet 33 (5):
387-94.
- Mokhtar MM, Abd el-Aziz AM,
Nazmy NA, Mahrous HS (2003) Cytogenetic profile of Down syndrome in
Alexandria, Egypt. East Mediterr Health J 9: 37-44.
- Azman BZ, Ankathil R, Siti
Mariam I, Suhaida MA, Norhashimah M, et al. (2007) Cytogenetic and
clinical profile of Down syndrome in Northeast Malaysia and Singapore. Med
J 48: 550-554.
- Jyothy A, Kumar KS, Rao GN,
Rao VB, Swarna M, et al. (2000) Cytogenetic studies of 1001 Down syndrome
cases from Andhra Pradesh, India. Ind. J. Med. Res 111: 133-137.
- Kothare S, Shetty N, Dave U
(2002) Maternal Age and Chromosomal Profile in 160 Down Syndrome Cases –
Experience of a Tertiary Genetic Centre from India. Int J Hum Genet 2:
49-53.
- Sheth F, Rao S, Desai M, Vin
J, Sheth J (2007) Cytogenetic Analysis of Down syndrome in Gujarat. Ind
Pediatr 44: 774-777.
- Harton GL, Tempest HG (2012)
Chromosomal disorders and male infertility. Asian J Androl 14:
32.
- Hawli Y, Nasrallah M,
Fuleihan GEH (2009) Endocrine and musculoskeletal abnormalities in
patients with Down syndrome. Nat
Rev Endocrinol 5:
327-334.
- Lien EA,
Nedrebø BG, Varhaug JE, Nygård O, Aakvaag A, et al. (2000) Plasma total homocysteine
levels during short-term iatrogenic hypothyroidism. J Clin Endocrinol
Metab 85: 1049-1053.
- Morris MS, Bostom AG, Jacques
PF, Selhub J, Rosenberg IH (2001) Hyperhomocysteinemia and
hypercholesterolemia associated with hypothyroidism in the third US
National Health and Nutrition Examination Survey. Atheroscler 155:
195-200.
- Diekman MJM, van der Put NM,
Blom HJ, Tijssen JGP, Wiersinga WM (2001) Determinants of changes in
plasma homocysteine in hyperthyroidism and hypothyroidism. Clin.
Endocrinol 54 : 197-204.
- Nygård O, Vollset SE, Refsum
H, Brattstro¨m L, Ueland PM (1999) Total homocysteine and cardiovascular
disease. J Intern Med 246: 425-454.
- Gibson PA, Newton RW, Selby
K, Price DA, Leyland K, Addison GM (2005) Longitudinal study of thyroid
function in Down’s syndrome in the first two decades. Arch Dis Child 90:
547-578.
- Hobbs CA, Sherman SL, Yi P,
Hopkins SE, Torfs CP, et al. (2000) Polymorphisms in genes involved in
folate metabolism as maternal risk factors for Down syndrome. Am J Hum Genet 67(3): 623-630.
- Monsen ALB, Ueland PM (2003)
Homocysteine and methylmalonic acid in diagnosis and risk assessment from
infancy to adolescence. Am J clin
nutrit 78: 7-21.
- Zhang Z, Shi Q, Liu Z,
Sturgis EM, Spitz MR, et al. (2005)
Polymorphisms of Methionine Synthase and Methionine Synthase
Reductase and Risk of Squamous Cell Carcinoma of the Head and Neck: a
Case-Control Analysis, Cancer Epidemiol Biomarkers Prev 14: 1188-1193.
- Gaughan DJ, Kluijtmans LA,
Barbaux S, McMaster DY, John SY et al. (2001) The methionine synthase
reductase (MTRR) A66G
polymorphism is a novel genetic determinant of plasma Hcy concentrations.
Atheroscler 157: 451-456.
- Sharma P, Senthilkumar RD,
Brahmachari V, Sundaramoorthy E, Mahajan A, et al. (2006) Mining
literature for a comprehensive pathway analysis: A case study for
retrieval of homocysteine related genes for genetic and epigenetic
studies. Lipids Health Dis 5: e1.
- Scala B, Granese M, Sellitto
S, Salome A, Sammartino A, et al. (2006) Andria, Analysis of seven
maternal polymorphisms of genes involved in homocysteine/folate metabolism
and risk of Down syndrome offspring. Genet Med 8: 409-416.
- Meguid NA,
Dardir AA, Khass M, El Hossieny L, Ezzat A, et al. (2008) MTHFR genetic
polymorphism as a risk factor in Egyptian mothers with Down syndrome
children. Diseas Mark 24: 19-26.
- Kohli U, Arora S, Kabra M,
Ramakrishnan L, Gulati S, et al. (2008) Prevalence of MTHFR C677T
polymorphism in north Indian mothers having babies with Trisomy 21 Down
syndrome. Downs Syn Dr Res Pract 12: 133-137.
- Dutta S, Das AB, Mukhopadhyay
K (2007) Risk of Down syndrome conferred by MTHFR C677T polymorphism:
Ethnic variations. Ind J Hum Genet 13: 76-77.
- Devi AR, Govindaiah V,
Ramakrishna G, Naushad SM (2004) Prevalence of methylene tetrahydrofolate
reductase polymorphism in South Indian population. Curr Scien 86: 440-443.
- Angeline T, Jeyaraj N,
Granito S, Tsongalis GJ (2004) Prevalence of MTHFR gene polymorphisms
(C677T and A1298C) among Tamilians. Exp Mol Pathol 7: 85-88.
- James SJ, Pogribna M,
Pogribny IP, Melnyk S, Hine RJ, et al. (1999) Abnormal folate metabolism
and mutation in the methylenetetrahydrofolate reductase gene may be
maternal risk factors for Down syndrome. Am J Clin Nutr 70: 495-501.
QUICK LINKS
- SUBMIT MANUSCRIPT
- RECOMMEND THE JOURNAL
-
SUBSCRIBE FOR ALERTS
RELATED JOURNALS
- Journal of Agriculture and Forest Meteorology Research (ISSN:2642-0449)
- Journal of Microbiology and Microbial Infections (ISSN: 2689-7660)
- Proteomics and Bioinformatics (ISSN:2641-7561)
- Advances in Nanomedicine and Nanotechnology Research (ISSN: 2688-5476)
- Journal of Womens Health and Safety Research (ISSN:2577-1388)
- Journal of Genetics and Cell Biology (ISSN:2639-3360)
- Journal of Veterinary and Marine Sciences (ISSN: 2689-7830)